1
ответ

Как посылание token в header Api fetch

я вторгаюсь в fetch, чтобы делать просьбы в публичную API, которая позволяла бы мне видеть котировки доллара моей страны, поставщик API дает мне ключ, что я должен включать ее в header...
вопрос задан: 08.03.2019
1
ответ

Правильный синтаксис, использовав inner join с пагинацией в Oracle

У меня есть следующий query: select * from (select rownum rnum, p.* from (select DEPARTMENTS.DEPARTMENT_ID, DEPARTMENTS.DEPARTMENT_NAME, DEPARTMENTS.MANAGER_ID, EMPLOYEES....
вопрос задан: 07.11.2018
1
ответ

Ошибка с header (location) [удвоенная]

у меня следующий код есть <? php if (! $ _GET) { header ('Location:blog.php? pagina=1'); }?> и он дает мне следующую ошибку:...
вопрос задан: 10.08.2018
1
ответ

Отказывать разрешение пользователям, кроме составителю C#

Я реализую приложение с маленьким очень основным модулем самозащиты на уровне безопасности пользователя, но не, как лишение разрешения настоящего пользователя, который не пишет в папке...
вопрос задан: 05.07.2018
1
ответ

Как я наполняю неудар в лунку со стоимостью localStorage, закончив refresh страницы?

Я пробую с этим; но у меня не выходит даже alert. <рукописный шрифт type = "text/javascript"> $ (window) .load (function () { alert ("обременительная Страница"); }); window.ready = function ()...
вопрос задан: 04.07.2018
1
ответ

составитель дает мне ошибку используя книжный магазин winsock

prueba.cpp: (. text+0x2d8): undefined reference to '__ imp_closesocket' я не понимаю, которому он проистекает, так со всеми переменными, связанными с winsock использованные в программе и, в этом случае он следует за мной...
вопрос задан: 27.05.2018
1
ответ

Как менять имя переменных на положение и не по имени с dplyr в R?

Прежде чем любая вещь, я хочу комментировать, что я реализовал изнурительные поиски перед тем, как реализовывать мой вопрос, не получая удовлетворительных результатов. Имена базы данных, которую я хочу использовать...
вопрос задан: 03.03.2018
1
ответ

ошибка recorer string с for в r

Я хочу пробежать string текста используя цикл, но выполнив в одинокий код, он делает мне первое повторение. text <-"CTGGTGCTCGTAGACCGCAGAACC"; i=0 i1=i+3 for (i in 1:length (text)) { DNA и...
вопрос задан: 27.10.2017
1
ответ

Как прочитать пакет, установленный в R

Я установил пакет ggplot2 в R, но при чтении его с помощью функции библиотеки (ggplot2) я получаю эту ошибку: Ошибка в loadNamespace (i, c (lib.loc, .libPaths ()), versionCheck = vI [[i] ]): ...
вопрос задан: 24.04.2017
1
ответ

Субменю, зло развернутое в Mozilla

Хорошие во все и все. Недавно я задал вопрос, чтобы делать меню responsive с шириной 100 % Веба в этой ссылке (спасибо за ответы), реализовав изменения и увидев, что...
вопрос задан: 13.04.2017
1
ответ

подтверждать, что класс получает в наследство другой

У меня есть проблема подтверждая, что класс получил в наследство другой. У меня есть следующий код: Class <Serializable> serializable = (Класс <Serializable>) Class.forName ("java.io. Serializable");...
вопрос задан: 19.12.2016
1
ответ

¿como dar formato a pesos en boostrap?

este es el código con el muestro la tabla <table id="table2" ng-init="loadData()"data-height="430" data-click-to-select="true"data-search="true"> <...
вопрос задан: 15.12.2016
1
ответ

¿Cómo puedo recorrer las filas de una tabla y ponerlas en formato html para enviar como cuerpo de un correo?

Tengo un procedimiento que captura los errores y los almacena en una tabla temporal, luego al final esa tabla temporal la envío en stored procedure y la recorro para darle un formato html a cada fila ...
вопрос задан: 01.12.2016
1
ответ

Actualizar o insertar registro utilizando 1 sentencia y 2 clausulas MYSQL

Tengo una tabla con las columnas id_autor, id_publicacion y fecha, lo que quisiera es que cuando el id_autor y el id_publicación sean iguales a los valores que les paso, actualice fecha, si ambos son ...
вопрос задан: 27.11.2016
1
ответ

Problema para modificar una variable con Vue.js

Tengo un problema con Vue js: Trato de hacer algo así como una lista de notas. Tengo un array de json donde se guardaran todas las notas y un json donde se guarda la nota que la persona quiere crear. ...
вопрос задан: 21.11.2016
1
ответ

Довод "против" Contar letras en una cadena en R, в то время как ()

отрасли buenas. Estoy tratando de hacer un ciclo, в то время как, para un conteo de letras. EL objetivo es obtener el conteo de las primeras 20 letras de una secuencia de ADN. El Script que tengo es: секунда <...
вопрос задан: 16.11.2016
1
ответ

Assert Failed: yield_processor: Stack overflow in thread … в informix [закрывшая]

Assert Failed: yield_processor: Stack overflow in thread.... в informix. как я избегаю того, чтобы это произошло для того, чтобы я не спустился механизм informix?
вопрос задан: 11.11.2016
1
ответ

ошибка в tapply внутри функции

Я хочу использовать tapply внутри функции для того, чтобы эта смогла воспроизводить различные тесты различных переменных даты frame, как он размножается в примере ↓↓. Когда я делаю tapply с df и...
вопрос задан: 28.10.2016
1
ответ

Существует способ менять язык Пичарм Эду 3.0 в испанца?

Мне хотелось бы знать, существует ли способ менять язык Пичарм Эду 3.0 в испанца, я работаю с детьми и им осложняется достаточно английский язык, так как это не Ваш натуральный язык.
вопрос задан: 07.09.2016
1
ответ

Показывать листает html через index.php> funcion.php

Я объясняюсь, потому что титул возможно собирался быть немного длинным, и захотел упростить это. У меня есть страница index.php, у нее есть таблица, где в tr, td (height и width уже установленные) у него есть один...
вопрос задан: 03.09.2016
1
ответ

Твиттер API возвращать список последователей более длинный, чем 70.000

Используя TwitterOauth, я стараюсь получать список последователей счета с большим списком последователей. Как API возвращает не более 5000 пользователей из-за request, продолжая совет...
вопрос задан: 19.08.2016
1
ответ

Как цифровой подписи PDF с php (symfony2)?

Доброе утро У меня вопрос, как я могу подписать PDF-файл цифровой подписью (или какие библиотеки мне следует использовать). Я работаю в рамках php symfony2. Заранее спасибо
вопрос задан: 12.08.2016
1
ответ

Как показывать “Push notification” с push.js единственный раз из-за пользователя с “localStorage”

Я имею будь push notification автоматическая в index.html, что он появляется каждый раз, когда они соглашаются на мой Веб, что я хочу сделать, состоит в том, чтобы с одиноким "localStorage" он появился однажды из-за пользователя и не был так...
вопрос задан: 12.08.2016
1
ответ

Как листать в PHP с MVC?

У меня есть драйвер и вид, которые функционируют верно, я это нашел в Интернете, но сейчас я хотел бы пролистать реестры и я не могу реализовать это с MVC: Драйвер class Home { public...
вопрос задан: 09.08.2016
1
ответ

Получать несколько свойств объекта

Привет мне хотелось бы знать, какие решения есть, чтобы уменьшать объект. Костлявая у меня есть модель, которая используется как возврат в драйвере, но только меня интересуют некие свойства этой модели....
вопрос задан: 12.07.2016
1
ответ

Получать определенную стоимость изображения

Я выдвигаю приложение для Android для управления затрат и мне поставило следующее сомнение: Возможно получать числовую определенную стоимость изображения? например, общее количество...
вопрос задан: 01.06.2016
1
ответ

Contct Form 7 в Wordpress не посылает e-mail

У меня есть последняя версия wordpress и contact form 7 и версия php сервера, который установлен, - 5.5 (последняя стабильная версия, как я понимаю). Это сервер доказательств....
вопрос задан: 16.05.2016
1
ответ

Как я могу менять язык dotproject в Испанца? [закрывшая]

Я установил dotproject и предопределенный язык эта на английском хотела изменить это в испанца и пробуя рекомендуемых форм и я не смог делать это, уже обработал информацию добавляя папку он...
вопрос задан: 12.05.2016
1
ответ

Почему не вводятся элементы в договоренности моего собственного класса?

Я осуществляю класс, который я хочу, чтобы он вел себя как мешок имен, в которые он мог бы входить только, я они назвал, что они не были заблаговременно в мешке. Мне дает неудача так как не я...
вопрос задан: 09.03.2016
1
ответ

Как избегать того, чтобы виртуальная клавиатура переделала размер вида в UIPopoverController?

Такой он такой, как я создал popover в view controller приложения: if (! _suggestionsPopover) { UIViewController *suggestionsViewController = [self.storyboard...
вопрос задан: 22.12.2015