7
ответов

Ты отличаешься между x ++ и ++ x

В коде я вижу часто x ++ в циклах, но когда-нибудь нахожусь ++ x.: Есть какое-то различие между этими двумя выражениями?
вопрос задан: 06.09.2017
5
ответов

Как создавать цепь текста с разделителями активно?

Этот вопрос - это, чтобы иметь очень простой прием, который я изучил в StackOverflow, и который служил для того, чтобы отложить тысячи случаев в моем коде. ЗАМЕТЬ: это не перевод, это просто одна...
вопрос задан: 10.06.2016
3
ответа

Bucle for números aleatorios

Estoy haciendo un ejercicio, en el cual se me pide generar unos números aleatorios para crear una combinación para la primitiva. Como condición es que cada número salga de un bucle for, os pongo mi ...
вопрос задан: 05.12.2016
3
ответа

Для цикла приращение не работает

У меня есть цикл for, который не работает для меня должным образом. Если я делаю отладку, приращение всегда сбрасывается до 0, поэтому оно достигает только 1. Вот часть кода: Сначала я делаю цикл for, чтобы ...
вопрос задан: 22.06.2016
2
ответа

Как сравнивать данные между array и укрытым array? [закрывшая]

Привет я имею по отношению ко всем следующий вызов, который состоит в доставлении данных укрытого array сравнивая их с array действительных данных: var validValues = ["0", "1"]; var corruptData = [["0", "2", ".
вопрос задан: 17.04.2018
2
ответа

Как делание loop в .gs для деталей реестров

У меня есть персонализированный формуляр, который требует, чтобы он построил количество N inputs и хранил их в spreadsheet, каждая информация должна регистрироваться как список как число созданных inputs....
вопрос задан: 17.03.2018
2
ответа

Счетчик увеличивается неожиданно внутри цикла

Я пробую способствовать малыш program в C ++ тому, чтобы он попросил у пользователя ранг стоимости (xmin, xmax), (ymin, ymax). Программа случайным образом выберет два типа стоимости между (xmin, xmax) и (ymin, ymax)...
вопрос задан: 09.12.2016
2
ответа

Как доставать 2 самых больших числа array с do-while?

У меня есть изложение, в котором они говорят мне, что я должен производить array взбираться с 8 случайными числами между 10 и 100 получая самый больший два, не используя функции max () и с do-while. Будь должен показывать меня...
вопрос задан: 23.11.2016
2
ответа

¿Cómo puedo obtener los nombres que acaban por una letra dentro de un array con PHP7?

Yo parto de un array, del cual debo obtener todos los nombres de los que acaben en s y almacenarlo en otro array. Para todos los que acaben en i también. Creo que lo más efectivo es hacer un foreach, ...
вопрос задан: 21.11.2016
2
ответа

pasar variable en loop entre páginas con sessions

He iniciado sesión en dos páginas. En ambas tengo una variable global de sesión. En la primera página esta variable está dentro de un loop. Lo que trato de hacer es enviar un valor de variable ...
вопрос задан: 19.11.2016
2
ответа

Calcular media aritmética con valores aleatorios PHP7

Tengo que hacer un bucle while para calcular la media aritmética de 15 números aleatorios. No me da error, pero se queda cargando continuamente: <?php //Función para números aleatorios function ...
вопрос задан: 07.11.2016
2
ответа

Довод "против" Problemas en while, если параграф acumular

Tengo un problema quiero hacer un acumulado de piezas y pagos dentro de un while y después acumular en base al empleado y следующий pintar los datos en pantalla. Pero se Сальта la información...
вопрос задан: 28.10.2016
2
ответа

Возвращать имя изменчивой только одной из-за повторения в R

Я использую в R lapply () с функцией и, вместо того, чтобы получать имя переменной, соответствующей каждому повторению, я получаю все имена переменных в каждом повторении. С...
вопрос задан: 24.10.2016
2
ответа

Консоль Mi programa se ejecuta más de una vez cuando ingreso datos desde

Вокал Lo que pasa es que quiero hacer un programa que me diga si el caracter que ingresé es o согласный: #include <stdio.h> международное основное () {символ a; интервал w=0; в то время как (w <=1) {...
вопрос задан: 19.10.2016
2
ответа

Как перейти от списка к data.frame в R?

Хорошо, я работаю над R со следующей таблицей "переходов": где я описываю количество посещений каждого пользователя на каждого пользователя. Моя цель - иметь возможность получить для каждого пользователя только ...
вопрос задан: 01.06.2016
2
ответа

Каков мотив бесконечного loop?

Хорошие во все. Я стараюсь реализовывать buscaminas в java и у меня есть проблема, которую до тех пор, пока он не решит я не могу продолжать продвигать. В этом участке кода производит бесконечный loop которую причину...
вопрос задан: 22.04.2016
1
ответ

Панды: Колонна datetime производит добавочные ошибочные даты, упорядочив, или которые нужно применить resample ()

я пробую упорядочивать колонну datetimes, у которого есть ранг между 2016-01-01 и 2019-02-14. Я извлекаю колонну с dataframe, который загружал бы отсюда (Данные). Одна из проблем, которые я нашел...
вопрос задан: 20.03.2019
1
ответ

Как возвращать договоренность обещаний?

Я стараюсь вооружать file tree view. Используя книжный магазин fs node и книжный магазин bluebird, чтобы направлять асинхронные методы, которые у них есть callback внутри книжного магазина fs, я прибыл к этой...
вопрос задан: 09.03.2019
1
ответ

Как я могу использовать модального как alert?

у меня есть проблема и дело в том, что я хочу войти в систему в bootstrap, и в момент нажимания на эту кнопку откройте файл javascript, чтобы сравнивать поля login и отсюда, если он правилен, покажите один...
вопрос задан: 20.02.2019
1
ответ

Cannot read property 'errors' of undefined at угловой Object.eval 7

У меня есть формуляр login, у которого есть основное удостоверение с spring security, и у меня выходит ошибка в html. Восток - мой html, я использую угловой материал: ' <form [formGroup] = "loginForm" (...
вопрос задан: 18.02.2019
1
ответ

ошибка recorer string с for в r

Я хочу пробежать string текста используя цикл, но выполнив в одинокий код, он делает мне первое повторение. text <-"CTGGTGCTCGTAGACCGCAGAACC"; i=0 i1=i+3 for (i in 1:length (text)) { DNA и...
вопрос задан: 27.10.2017
1
ответ

Делать операции на колоннах в одной цикл Dataframe

Я хочу сделать вычисления на трех колоннах array values_array. def calculateAllEMA (self, values_array): df = pd. DataFrame (values_array, columns = ['BTC', 'ETH', 'DASH']) for i, column in...
вопрос задан: 11.08.2017
1
ответ

В iOS мой CSS не применяется

Проблема у меня наверняка будет глупой, но я не нашел ничего, чтобы решить ее. У меня есть CSS, который применяет стили в зависимости от экрана, то есть мой сайт отзывчивый ...
вопрос задан: 20.06.2017
1
ответ

Использовав (String. Format (“{0:#-#-##}”, item.codigo)) в статье списка, orde by valor_id теряет MVC C#

У меня есть siguienta, увиденный, что берется за то, чтобы показывать код в этом format 9-9-99. И с controller я показываю ему, что он мстит упорядоченный кодом, который сохранялся в целом числе: <table пойдите = "...
вопрос задан: 27.08.2016
1
ответ

Обнаруживать активность вызова Whatsapp

я новый в этом разработки приложений на android, у меня есть сомнение на java приложения, которое могло бы, дезактивируй вызовы whatsapp: они знают, который является этим решением или чем-то, что он идентифицировал бы...
вопрос задан: 19.08.2016
1
ответ

Связь между двумя подмостками с id различный

Я пробую делать связь между таблицей пользователи и таблица предприятия, база данных была создана заблаговременно вне rails, из-за того, что primary key предприятий - "idempresa" и...
вопрос задан: 11.07.2016
1
ответ

Как Призывать EJB с удаленного Server в другой server. используя WILDFLY 10 и JSP?

В настоящее время я разрабатываю Веб приложение в JSP с WILDFLY 10. В настоящее время мое приложение разделено на модули, но я разворачиваю все с тем же EAR. Моя идея состоит в том, чтобы разделять приложение в...
вопрос задан: 14.06.2016
1
ответ

Мигрировать Android в [закрытого] Phonegap

Мальчики, у меня есть сомнение, что я надеюсь, что они помогают мне решать. Вопрос - что, если могут мигрировать приложение Андроид Студио к PhoneGap? Я жду Ваши ответы, привет.
вопрос задан: 26.05.2016
1
ответ

Как устанавливать разрешения с Джанго Апи Рест Framework?

Моя проблема или сомнение - это как использование разрешений, которые считают распределенными пользователи, уже принадлежите группе или индивидуальным разрешениям, для того, чтобы, когда пользователь logea используя одинокий Джанго Рест Фрамеворк будет им
вопрос задан: 01.03.2016
1
ответ

Как повторно присоединять клиент wasync (atmosphere), когда падает сервер?

Я разрабатываю проект, для которого я должен осуществлять извещения PUSH с сервером atmosphere. Для этого я использую клиент wasync. В первоначальном проекте, говорится об одном...
вопрос задан: 17.02.2016